Volume 39 Issue 6
Jun.  2020
Turn off MathJax
Article Contents

Qian Ma, Xinfu Liu, Ang Li, Shufang Liu, Zhimeng Zhuang. Effects of osmotic stress on the expression profiling of aquaporin genes in the roughskin sculpin (Trachidermus fasciatus)[J]. Acta Oceanologica Sinica, 2020, 39(6): 19-25. doi: 10.1007/s13131-020-1594-0
Citation: Qian Ma, Xinfu Liu, Ang Li, Shufang Liu, Zhimeng Zhuang. Effects of osmotic stress on the expression profiling of aquaporin genes in the roughskin sculpin (Trachidermus fasciatus)[J]. Acta Oceanologica Sinica, 2020, 39(6): 19-25. doi: 10.1007/s13131-020-1594-0

Effects of osmotic stress on the expression profiling of aquaporin genes in the roughskin sculpin (Trachidermus fasciatus)

doi: 10.1007/s13131-020-1594-0
Funds:  The Qingdao Applied Basic Research Project under contract No. 14-2-4-15-jch; the National Natural Science Foundation of China under contract No. 31772828.
More Information
  • Corresponding author: E-mail: maq@gdou.edu.cn
  • Received Date: 2019-09-19
  • Accepted Date: 2019-11-15
  • Available Online: 2020-12-28
  • Publish Date: 2020-06-25
  • Aquaporins (AQPs) are a family of integral membrane proteins that have been shown to be important for osmoregulation in many vertebrates. To identify potential stress resistance-related aqp genes in salinity adaptation of the roughskin sculpin Trachidermus fasciatus, we investigated the time-course expression dynamics of seven aquaporin genes (aqp1, 4, 7, 8, 10, 11 and 12) in three osmoregulatory tissues (kidney, gill and intestine) and one metabolic tissue (liver). The fish were subjected to two different acute osmotic treatments (seawater-to-freshwater transfer respectively achieved in 1 h and 24 h, namely, E-acute and acute group). The expression profiling of the seven aqp genes were performed using quantitative real-time PCR (qRT-PCR). At the time of all sampling time points (0 h, 12 h, 24 h and 48 h), no expression of aqp4 was found in the gill, liver and intestine; no expression of aqp7 was found in the gill and liver. Significant differences of aqp expression were determined in the four target tissues, and the mRNA levels were largely variable among gene members and tissues. Similar patterns of the time-course expression were detected in most of the aqp genes in T. fasciatus between the two acute groups, except that only one gene (aqp12) in the kidney and three genes (aqp7, aqp8 and aqp10) in the intestine revealed different expression patterns. These results suggest that the expression response of aqp genes was similar under osmotic changes with different rates.
  • 加载中
  • [1] Agre P, King L S, Yasui M, et al. 2002. Aquaporin water channels-from atomic structure to clinical medicine. Journal of Physiology, 542(1): 3–16. doi:  10.1113/jphysiol.2002.020818
    [2] An K W, Kim N N, Choi C Y. 2008. Cloning and expression of aquaporin 1 and arginine vasotocin receptor mRNA from the black porgy, Acanthopagrus schlegeli: effect of freshwater acclimation. Fish Physiology and Biochemistry, 34(2): 185–194. doi:  10.1007/s10695-007-9175-0
    [3] Aoki M, Kaneko T, Katoh F, et al. 2003. Intestinal water absorption through aquaporin 1 expressed in the apical membrane of mucosal epithelial cells in seawater-adapted Japanese eel. Journal of Experimental Biology, 206(19): 3495–3505. doi:  10.1242/jeb.00579
    [4] Cao Jun, Shi Feng. 2019. Comparative analysis of the aquaporin gene family in 12 fish species. Animals, 9(5): 233. doi:  10.3390/ani9050233
    [5] Cerdà J, Finn R N. 2010. Piscine aquaporins: an overview of recent advances. Journal of Experimental Zoology Part A, 313A(10): 623–650. doi:  10.1002/jez.634
    [6] Choi Y J, Shin H S, Kim N N, et al. 2013. Expression of aquaporin-3 and -8 mRNAs in the parr and smolt stages of sockeye salmon, Oncorhynchus nerka: effects of cortisol treatment and seawater acclimation. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 165(2): 228–236
    [7] Cutler C P, Cramb G. 2000. Water transport and aquaporin expression in fish. In: Hohmann S, Nielsen S, eds. Molecular Biology and Physiology of Water and Solute Transport. Boston: Springer, 433–441
    [8] Cutler C P, Cramb G. 2002. Branchial expression of an aquaporin 3(AQP-3) homologue is downregulated in the European eel Anguilla anguilla following seawater acclimation. Journal of Experimental Biology, 205(17): 2643–2651
    [9] Cutler C P, Martinez A S, Cramb G. 2007. The role of aquaporin 3 in teleost fish. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 148(1): 82–91
    [10] Cutler C P, Philips C, Hazon N, et al. 2009. Aquaporin 8 (AQP8) intestinal mRNA expression increases in response to salinity acclimation in yellow and silver European eels (Anguilla anguilla). Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 153(2): S78
    [11] Engelund M B, Madsen S S. 2011. The role of aquaporins in the kidney of euryhaline teleosts. Frontiers in Physiology, 2: 51
    [12] Engelund M B, Madsen S S. 2015. Tubular localization and expressional dynamics of aquaporins in the kidney of seawater-challenged Atlantic salmon. Journal of Comparative Physiology B, 185(2): 207–223. doi:  10.1007/s00360-014-0878-0
    [13] Finn R N, Cerdà J. 2011. Aquaporin evolution in fishes. Frontiers in Physiology, 2: 44
    [14] Giffard-Mena I, Boulo V, Abed C, et al. 2011. Expression and localization of aquaporin 1a in the sea-bass (Dicentrarchus labrax) during Ontogeny. Frontiers in Physiology, 2: 34
    [15] Giffard-Mena I, Boulo V, Aujoulat F, et al. 2007. Aquaporin molecular characterization in the sea-bass (Dicentrarchus labrax): the effect of salinity on AQP1 and AQP3 expression. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 148(2): 430–444
    [16] Giffard-Mena I, Lorin-Nebel C, Charmantier G, et al. 2008. Adaptation of the sea-bass (Dicentrarchus labrax) to fresh water: role of aquaporins and Na+/K+-ATPases. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 150(3): 332–338
    [17] Gonzalez R J. 2012. The physiology of hyper-salinity tolerance in teleost fish: a review. Journal of Comparative Physiology B, 182(3): 321–329. doi:  10.1007/s00360-011-0624-9
    [18] Gorelick D A, Praetorius J, Tsunenari T, et al. 2006. Aquaporin-11: a channel protein lacking apparent transport function expressed in brain. BMC Biochemistry, 7: 14. doi:  10.1186/1471-2091-7-14
    [19] Goto A. 1990. Alternative life-history styles of Japanese freshwater sculpins revisited. Environmental Biology of Fishes, 28(1–4): 101–112. doi:  10.1007/BF00751030
    [20] Hamdi M, Sanchez M A, Beene L C, et al. 2009. Arsenic transport by zebrafish aquaglyceroporins. BMC Molecular Biology, 10: 104. doi:  10.1186/1471-2199-10-104
    [21] Hara-Chikuma M, Verkman A S. 2006. Physiological roles of glycerol-transporting aquaporins: the aquaglyceroporins. Cellular and Molecular Life Sciences CMLS, 63(12): 1386–1392. doi:  10.1007/s00018-006-6028-4
    [22] Harper C, Wolf J C. 2009. Morphologic effects of the stress response in fish. Ilar Journal, 50(4): 387–396. doi:  10.1093/ilar.50.4.387
    [23] Ip Y K, Soh M M L, Chen X L, et al. 2013. Molecular characterization of branchial aquaporin 1aa and effects of seawater acclimation, emersion or ammonia exposure on its mRNA expression in the gills, gut, kidney and skin of the freshwater climbing perch, Anabas testudineus. PLoS One, 8(4): e61163. doi:  10.1371/journal.pone.0061163
    [24] Itoh T, Rai T, Kuwahara M, et al. 2005. Identification of a novel aquaporin, AQP12, expressed in pancreatic acinar cells. Biochemical and Biophysical Research Communications, 330(3): 832–838. doi:  10.1016/j.bbrc.2005.03.046
    [25] Jeong S Y, Kim J H, Lee W O, et al. 2014. Salinity changes in the anadromous river pufferfish, Takifugu obscurus, mediate gene regulation. Fish Physiology and Biochemistry, 40(1): 205–219. doi:  10.1007/s10695-013-9837-z
    [26] Kim Y K, Lee S Y, Kim B S, et al. 2014. Isolation and mRNA expression analysis of aquaporin isoforms in marine medaka Oryzias dancena, a euryhaline teleost. Comparative Biochemistry and Physiology Part A: Molecular & Integrative Physiology, 171: 1–8
    [27] Kim Y K, Watanabe S, Kaneko T, et al. 2010. Expression of aquaporins 3, 8 and 10 in the intestines of freshwater- and seawater-acclimated Japanese eels Anguilla japonica. Fisheries Science, 76(4): 695–702. doi:  10.1007/s12562-010-0259-x
    [28] King L S, Kozono D, Agre P. 2004. From structure to disease: the evolving tale of aquaporin biology. Nature Reviews Molecular Cell Biology, 5(9): 687–698. doi:  10.1038/nrm1469
    [29] Lema S C, Carvalho P G, Egelston J N, et al. 2018. Dynamics of gene expression responses for ion transport proteins and aquaporins in the gill of a euryhaline pupfish during freshwater and high-salinity acclimation. Physiological and Biochemical Zoology, 91(6): 1148–1171. doi:  10.1086/700432
    [30] Livak K J, Schmittgen T D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the $2^{-\Delta\Delta {C_{\rm T}}} $ method. Methods, 25(4): 402–408. doi:  10.1006/meth.2001.1262
    [31] Ma Qian, Liu Xinfu, Feng Wenrong, et al. 2018. Analyses of the molecular mechanisms associated with salinity adaption of Trachidermus fasciatus through combined iTRAQ-based proteomics and RNA sequencing-based transcriptomics. Progress in Biophysics and Molecular Biology, 136: 40–53. doi:  10.1016/j.pbiomolbio.2018.02.003
    [32] Madsen S S, Engelund M B, Cutler C P. 2015. Water transport and functional dynamics of aquaporins in osmoregulatory organs of fishes. The Biological Bulletin, 229(1): 70–92. doi:  10.1086/BBLv229n1p70
    [33] Marshall W S, Grosell M. 2006. Ion transport, osmoregulation, and acid-base balance. The Physiology of Fishes, 3: 177–230
    [34] Martinez A S, Cutler C P, Wilson G D, et al. 2005. Regulation of expression of two aquaporin homologs in the intestine of the European eel: effects of seawater acclimation and cortisol treatment. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 288(6): R1733–R1743. doi:  10.1152/ajpregu.00747.2004
    [35] Mobasheri A, Marples D. 2004. Expression of the AQP-1 water channel in normal human tissues: a semiquantitative study using tissue microarray technology. American Journal of Physiology-Cell Physiology, 286(3): C529–C537. doi:  10.1152/ajpcell.00408.2003
    [36] Nielsen S, Frokiaer J, Marples D, et al. 2002. Aquaporins in the kidney: from molecules to medicine. Physiological Reviews, 82(1): 205–244. doi:  10.1152/physrev.00024.2001
    [37] Raldúa D, Otero D, Fabra M, et al. 2008. Differential localization and regulation of two aquaporin-1 homologs in the intestinal epithelia of the marine teleost Sparus aurata. American Journal of Physiology-Regulatory, Integrative and Comparative Physiology, 294(3): R993–R1003. doi:  10.1152/ajpregu.00695.2007
    [38] Santos C R A, Estêvão M D, Fuentes J, et al. 2004. Isolation of a novel aquaglyceroporin from a marine teleost (Sparus auratus): function and tissue distribution. Journal of Experimental Biology, 207(7): 1217–1227. doi:  10.1242/jeb.00867
    [39] Takata K, Matsuzaki T, Tajika Y. 2004. Aquaporins: water channel proteins of the cell membrane. Progress in Histochemistry and Cytochemistry, 39(1): 1–83. doi:  10.1016/j.proghi.2004.03.001
    [40] Tingaud-Sequeira A, Calusinska M, Finn R N, et al. 2010. The zebrafish genome encodes the largest vertebrate repertoire of functional aquaporins with dual paralogy and substrate specificities similar to mammals. BMC Evolutionary Biology, 10: 38. doi:  10.1186/1471-2148-10-38
    [41] Tingaud-Sequeira A, Chauvigné F, Fabra M, et al. 2008. Structural and functional divergence of two fish aquaporin-1 water channels following teleost-specific gene duplication. BMC Evolutionary Biology, 8: 259. doi:  10.1186/1471-2148-8-259
    [42] Tipsmark C K, Sørensen K J, Madsen S S. 2010. Aquaporin expression dynamics in osmoregulatory tissues of Atlantic salmon during smoltification and seawater acclimation. Journal of Experimental Biology, 213(3): 368–379. doi:  10.1242/jeb.034785
    [43] Verkman A S, Binder D K, Bloch O, et al. 2006. Three distinct roles of aquaporin-4 in brain function revealed by knockout mice. Biochimica et Biophysica Acta (BBA)—Biomembranes, 1758(8): 1085–1093. doi:  10.1016/j.bbamem.2006.02.018
    [44] Watanabe S, Kaneko T, Aida K. 2005. Aquaporin-3 expressed in the basolateral membrane of gill chloride cells in Mozambique tilapia Oreochromis mossambicus adapted to freshwater and seawater. Journal of Experimental Biology, 208(14): 2673–2682. doi:  10.1242/jeb.01684
  • 加载中
通讯作者: 陈斌, bchen63@163.com
  • 1. 

    沈阳化工大学材料科学与工程学院 沈阳 110142

  1. 本站搜索
  2. 百度学术搜索
  3. 万方数据库搜索
  4. CNKI搜索

Figures(4)  / Tables(1)

Article Metrics

Article views(37) PDF downloads(1) Cited by()

Related
Proportional views

Effects of osmotic stress on the expression profiling of aquaporin genes in the roughskin sculpin (Trachidermus fasciatus)

doi: 10.1007/s13131-020-1594-0
Funds:  The Qingdao Applied Basic Research Project under contract No. 14-2-4-15-jch; the National Natural Science Foundation of China under contract No. 31772828.

Abstract: Aquaporins (AQPs) are a family of integral membrane proteins that have been shown to be important for osmoregulation in many vertebrates. To identify potential stress resistance-related aqp genes in salinity adaptation of the roughskin sculpin Trachidermus fasciatus, we investigated the time-course expression dynamics of seven aquaporin genes (aqp1, 4, 7, 8, 10, 11 and 12) in three osmoregulatory tissues (kidney, gill and intestine) and one metabolic tissue (liver). The fish were subjected to two different acute osmotic treatments (seawater-to-freshwater transfer respectively achieved in 1 h and 24 h, namely, E-acute and acute group). The expression profiling of the seven aqp genes were performed using quantitative real-time PCR (qRT-PCR). At the time of all sampling time points (0 h, 12 h, 24 h and 48 h), no expression of aqp4 was found in the gill, liver and intestine; no expression of aqp7 was found in the gill and liver. Significant differences of aqp expression were determined in the four target tissues, and the mRNA levels were largely variable among gene members and tissues. Similar patterns of the time-course expression were detected in most of the aqp genes in T. fasciatus between the two acute groups, except that only one gene (aqp12) in the kidney and three genes (aqp7, aqp8 and aqp10) in the intestine revealed different expression patterns. These results suggest that the expression response of aqp genes was similar under osmotic changes with different rates.

Qian Ma, Xinfu Liu, Ang Li, Shufang Liu, Zhimeng Zhuang. Effects of osmotic stress on the expression profiling of aquaporin genes in the roughskin sculpin (Trachidermus fasciatus)[J]. Acta Oceanologica Sinica, 2020, 39(6): 19-25. doi: 10.1007/s13131-020-1594-0
Citation: Qian Ma, Xinfu Liu, Ang Li, Shufang Liu, Zhimeng Zhuang. Effects of osmotic stress on the expression profiling of aquaporin genes in the roughskin sculpin (Trachidermus fasciatus)[J]. Acta Oceanologica Sinica, 2020, 39(6): 19-25. doi: 10.1007/s13131-020-1594-0
    • The ability of teleosts to cope with environmental salinity changes depends on their capacity in the maintenance of water homeostasis (Harper and Wolf, 2009). Membrane intrinsic proteins (MIP) such as aquaporins (AQPs) are a family of integral membrane proteins that transport water and small molecular weight solutes across biological membranes (Agre et al., 2002; King et al., 2004). The first report on fish aqp appeared in year 2000 (Cutler and Cramb, 2000). As reported, the role of AQPs is suspected to be related to conservation of water in seawater (SW) and possibly excretion of water in freshwater (FW) (Cerdà and Finn, 2010). To date, a total of 13 different subfamilies have been described in the AQP superfamily of fish, which differ in tissue expression, regulation and selectivity (King et al., 2004; Takata et al., 2004). These subfamilies include classical AQPs (AQP-0, -1, -2, -4, -5 and -6), aquaglyceroporins (AQP-3, -7, -9 and -10), aquaporin-8 (AQP-8), and unorthodox aquaporins (AQP-11 and -12) (Finn and Cerdà, 2011).

      In mammals, AQP1 and AQP2 are essential for water resorption in the kidney (Nielsen et al., 2002), AQP4 is involved in cerebral water balance, astrocyte migration and neural signal transduction (Verkman et al., 2006), while AQP3 and AQP7 seem to play important roles during skin hydration and metabolism of adipocytes (Hara-Chikuma and Verkman, 2006). In teleosts, water transport performances at the molecular level seem to be uncertain across different organs, species and their respective ecophases (Aoki et al., 2003; Martinez et al., 2005). The physiological role of teleost AQPs is particularly important in osmoregulatory organs (kidney, gill and intestine), where certain AQPs would be significantly modulated during osmotic challenges (Cutler and Cramb, 2002; Watanabe et al., 2005; Kim et al., 2010; Giffard-Mena et al., 2011; Choi et al., 2013; Lema et al., 2018; Cao and Shi, 2019). As for kidney, 11 orthologs of AQPs (AQP-1aa, -1ab, -3a, -3b, -7, -8aa, -8ab, -9a, -10a, -10b and -12) have been reported in various teleost species (Cerdà and Finn, 2010). Research on the role of these aqp genes in fish has so far focused on aqp1, aqp3 and aqp4, which are mainly expressed in osmoregulatory tissues (the gill, the gastro-intestinal tract and the kidney) (Engelund and Madsen, 2011, 2015).

      The roughskin sculpin Trachidermus fasciatus exhibits a catadromous lifestyle and migrates between freshwater and seawater during its life cycle (Goto, 1990). Previously, the possibility of selecting T. fasciatus as an experimental animal for osmoregulation studies was proposed; a kidney-specific transcriptome was performed to identify important regulators and pathways involved in salinity adaption of this euryhaline species, and a total of seven aqps were identified (Ma et al., 2018). As for certain aqps, tissue-specific or ubiquitous expression patterns at mRNA levels would be identified depending on isoforms (Cerdà and Finn, 2010). Hence, the aim of this study was to investigate the expression pattern of each aqp in different tissues of T. fasciatus to better understand the role of AQPs and regulatory mechanism of euryhaline fish in response to salinity stress.

      A complex physiological process, involving structural and functional modifications in the osmoregulatory organs (gill, kidney or intestine), was involved in salinity adaptation in teleosts (Marshall and Grosell, 2006; Gonzalez, 2012). Additionally, the liver plays a primary role in maintaining metabolic homeostasis; and it is also an organ essential for stress response in fish. Since the responses to salinity challenges are likely to vary among tissues, all the four aforementioned tissues were selected. In the present study, fish were subjected to two salinity treatments (one extreme acute and the other relatively chronic seawater-to-freshwater transfer), mRNA levels of the seven aqps were determined in the aforementioned four tissues at different time points along with the salinity treatments. Comparison of the tissue expression pattern of aqps was performed to better understand the role of the seven genes as well as the molecular mechanism involved in osmoregulation of T. fasciatus.

    • Trachidermus fasciatus were collected at the Yuhai Hatchery Station (Shandong, China) in December 2014, and then transported to the Tongyong Hatchery Station (Qingdao, China) where the experiments were carried out. A total of 216 fish (standard length (12.22±0.91) cm, body mass (19.54±5.17) g) were equally separated and every 18 fish was acclimated in a flat bottom FRP (Fiber Reinforced Plastic) tank with an effective volume of 100 L, the fish reared in 12 tanks were under a 12 h light:12 h dark photoperiod for two weeks prior to the beginning of the experiments. Over 600 L sand-filtered natural sea water (salinity of 30, temperature of 10–12°C) was supplied to each tank per day.

      At the start of the experiments (time 0 h), three individuals from each tank were collected as controls while fish remained at seawater (30). Salinity change commenced thereafter by varying the inflowing seawater to freshwater (from 30 to 3) to each tank. Two different experiments were set up as followed: (1) salinity was sharply reduced and the water change took about 1 h (extreme acute group, E-acute, salinity changing rate of 27 h–1); (2) salinity was gradually reduced and the water change took about 24 h (acute group, relatively chronic comparing to the E-acute group, salinity changing rate of 1.1 h–1). Each experiment was performed with six replicates. Three individuals were randomly collected from each group at the time of 12 h, 24 h and 48 h, tissues (gill, intestine, kidney and liver) from each fish were firstly dissected and frozen in liquid nitrogen, and then samples from the same time point of the same treatment were respectively pooled to form sample pools. These sample pools were used to get tissue homogenates of total RNA. All the experimental animal procedures involved in this study were approved by the Yellow Sea Fisheries Research Institute′s animal care and use committee.

    • Total RNA was extracted from frozen tissues using TRIzol Reagent (Invitrogen, USA) according to the manufacturer′s instructions. The isolated RNA samples were suspended in DEPC-treated water, quantified using NanoVueTM (GE Healthcare) at A260 nm and A280 nm, and then analyzed for integrity on agarose gel. The first-strand cDNA was synthesized from total RNA using PrimeScriptTM RT reagent Kit with gDNA Eraser (Takara Bio., China) following the manufacturer′s instructions. The cDNA synthesis included a genomic DNA elimination reaction and the RT Primer Mix contained both Oligo dT Primer and Random 6 mers.

    • Primers for the quantitative real time PCR (qRT-PCR) were designed according to the sequences of T. fasciatus aqp genes based on the RNA-Seq data (NCBI accession number SRP103494) obtained in our lab. The primer sequences were listed in Table 1. The qRT-PCR was conducted by a 7500 ABI real time PCR system (Applied Biosystems, USA). Amplifications were performed in a 20 μL final volume containing 1 μL cDNA sample, 10 μL SYBR® Premix Ex TaqTM (Takara Bio., China), 0.4 μL ROXII, 0.4 μL of each primer and 7.8 μL ddH2O. Control amplifications were always included. PCR amplifications were performed in triplicate, using the following conditions: initial denaturing at 95°C for 10 s, followed by 40 cycles of 5 s at 95°C and 34 s at 60°C. A dissociation protocol was always performed after thermocycling to determine target specificity. Expression of 18s was used as the internal control. The ratio changes in the target genes relative to the control gene were determined by the 2–ΔΔCT method (Livak and Schmittgen, 2001) and the transcript level was described in terms of its relative concentration (RCtarget/RCcontrol).

      Name Primer sequences (5′ to 3′) Amplification target
      AQP1-RT-F TGACACCGTTGAGAGAGTTGAG Expression of aqp1
      AQP1-RT-R CTTGTTCAAGGCCGTCATGTAC
      AQP4-RT-F CCAATTGAGAGGCTGGCAGA Expression of aqp4
      AQP4-RT-R GCTGCTGTCAGAGGGTCATT
      AQP7-RT-F TGATGGCTTTGTCGGATCAGAA Expression of aqp7
      AQP7-RT-R TGCTGCCCAGAGAAATACCAAT
      AQP8-RT-F AAACAGGCTGGTCCCAAACA Expression of aqp8
      AQP8-RT-R CAGCTGAGAGAGGCAACACA
      AQP10-RT-F AGAGCCGCATCCAAACAGAA Expression of aqp10
      AQP10-RT-R CTCACCTGCATGCAGAGGAA
      AQP11-RT-F AAACTCCCACCTGGAATACTGC Expression of aqp11
      AQP11-RT-R CTCTTCTTGGTCTCCTGGAGGA
      AQP12-RT-F CTGGAGGTGCAGACCATCG Expression of aqp12
      AQP12-RT-R CTCCAGCTGCAGGAACCTC
      18S-F TTTCGAGGCCCTGTAATTGGAA Expression of 18s
      18S-R CCGAGATCCAACTACGAGCTTT

      Table 1.  Oligonucleotide primers used in this study

    • The heatmap analysis of aquaporin genes (scale=“row”, cluster rows TRUE) was performed using the OmicShare tools, a free online platform for data analysis (http://www.omicshare.com/tools). All data were expressed as mean±standard deviation (SD) and analyzed by one-way ANOVA (analysis of variance) to determine significant differences between the treatments and control using the Statistical Package for the Social Sciences, SPSS (version 16.0). Values were considered statistically significant when P<0.05.

    • As shown in Fig. 1, no expression of aqp4 and aqp7 could be detected in the gill. The expression of aqp1, aqp10, aqp11 and aqp12 were up-regulated at 12 h, and then followed by a down-regulation in both E-acute and acute group in response to salinity changes. The increment of aqp8 transcripts in the acute group was detected at 24 h, and then followed by a decrement at 48 h; while in the E-acute group, aqp8 expression kept increasing from 12 h to 48 h, and reached a two-fold higher level. As for the patterns of the five aqp genes expressed in the gill, aqp10 and aqp11 clustered in samples from both the two acute groups (Fig. 1), but a cluster of aqp1 and aqp12 was only found in the E-acute group (Fig. 1b).

      Figure 1.  Clustered heatmap of aquaporin genes expressed in the gill of Trachidermus fasciatus in response to seawater-to-freshwater transfer. Genes were clustered according to their expression pattern. a. Acute group and b. extreme acute group.

      The seven candidate genes revealed different expression patterns in the kidney (Fig. 2). Significant decrease of aqp1 and aqp4 expression was detected at the 48 h time point, no significant difference of the gene expression pattern was found between the two treatments. Significant increase of aqp7 could be identified at 12 h in the E-acute group, and the average increment is about four times as much as that at 0 h; aqp7 was not significantly altered in the acute group. As for aqp8, the mRNA level firstly increased and then followed by a decrement in both group. The aqp10 had an opposite trend that the expression firstly decreased and then increased. No significant change of aqp11 expression was found in the kidney. When comparing the mRNA level of aqp12 under the two treatments, an opposite trend was observed that the aqp12 mRNA level was significantly decreased in the acute group but increased in the E-acute group. As shown in Fig. 2, similar pattern of aqp10 and aqp11 expression were identified in both E-acute and an acute group, other than that, expression pattern of the other five genes did not reveal any similarities in the clustering results between the two groups.

      Figure 2.  Clustered heatmap of aquaporin genes expressed in the kidney of Trachidermus fasciatus in response to seawater-to-freshwater transfer. Genes were clustered according to their expression pattern. a. Acute group and b. extreme acute group.

      As for the intestine, no expression of aqp4 could be detected in the two groups (Fig. 3). Similar expression pattern of aqp1 was found in E-acute and acute group; the mRNA level increased at 12 h, then decreased at 24 h and followed by a increment at 48 h. The expression of aqp11 and aqp12 were increased following the salinity treatment in both groups. However, the expression of aqp8 and aqp10 in the two groups showed different patterns; the mRNA level in the acute group was slightly increased at 48 h following the significant decrease at 12 h, but in the E-acute group the expression at 48 h was significantly higher comparing to that at 0 h. The aqp7 gene also showed different expression pattern under different treatments. According to the heatmap, two major clusters in the acute group were shown in Fig. 3a; one was composed of aqp11 and aqp12, the other was composed of aqp1, aqp7, aqp8 and aqp10. In the E-acute group, two different major clusters was identified, one was composed of aqp1 and aqp11, one with the other four genes.

      Figure 3.  Clustered heatmap of aquaporin genes expressed in the intestine of Trachidermus fasciatus in response to seawater-to-freshwater transfer. Genes were clustered according to their expression pattern. a. Acute group and b. extreme acute group.

      The aqp genes showed different expression patterns in the liver in response to the two salinity treatments (Fig. 4). No expression of aqp4, aqp7 could be detected. No expression of aqp8 could be found before the treatments; but the aqp8 expression was respectively activated at 12 h in the acute group and 48 h in the E-acute group. The expression trend of aqp1, aqp11 and aqp12 in the acute group was in accordance with that in the E-acute group; an up-regulation of aqp1 as well as a down-regulation of aqp10, aqp11 and aqp12 was found in the two groups. In the acute group, expression of aqp10 at 12 h was over 8-fold higher than that at 0 h. The heatmap showed very similar clustering patterns between the two groups, one major cluster consisted of aqp1, aqp8 and aqp10, and the other consisted of aqp11 and aqp12.

      Figure 4.  Clustered heatmap of aquaporin genes expressed in the liver of Trachidermus fasciatus in response to seawater-to-freshwater transfer. Genes were clustered according to their expression pattern. a. Acute group and b. extreme acute group.

    • The putative aquaporin genes (aqp1, 4, 7, 8, 10, 11 and 12) were identified based on sequencing data of a kidney-specific transcriptome of T. fasciatus (Ma et al., 2018). As for other teleosts, the first aquaporin reported in kidney was an aqp10-like paralog in gilthead seabream (Santos et al., 2004). The aqp3 paralogs have also been investigated in the kidney of a few fish species (Engelund and Madsen, 2011; Cutler et al., 2007), however, no expression of aqp3 was found in the kidney of T. fasciatus. In the gill, several aqp paralogs have been detected, and these genes are believed to be more important in cell volume regulatory response than in transepithelial water exchange (Madsen et al., 2015). In the intestine, the aqp expression pattern often varies within different intestinal segments (Kim et al., 2010).

    • The wide distribution of aqp1 transcripts has been detected in endothelial barriers of almost all tissues in mammals (Mobasheri and Marples, 2004; Tingaud-Sequeira et al., 2008, 2010). The aqp1 mRNA could be found in most tissues of fish but its expression in the intestine and kidney predominated. The transcript level of aqp1 was present in the kidney of various fish, and the role of aqp1 in osmoregulation has been widely studied (Kim et al., 2014; Ip et al., 2013; An et al., 2008; Engelund and Madsen, 2015). Here in this study, the aqp1 was expressed in all the four target tissues (the gill, kidney, intestine and liver). The aqp1 mRNA level in the kidney of fish from the two groups both decreased following the salinity decline, which is as what would be expected. It has been previously reported that the aqp1 mRNA in the kidney of seabass Dicentrarchus labrax was four to five times higher in SW- than in FW-acclimated fish (Giffard-Mena et al., 2008). Tipsmark et al. (2010) reported an increasing mRNA level of aqp1aa in the Atlantic salmon Salmo salar kidney during SW-acclimation.

      In marine medaka, SW-acclimated fish exhibited higher levels of aqp1 transcripts in the kidney, whereas lower levels in gill, muscle and ovary (Kim et al., 2014). Moreover, other teleosts such as black porgy Acanthopagrus schlegelii (An et al., 2008), river pufferfish Takifugu obscurus (Jeong et al., 2014) exhibited higher gill aqp1 expression in FW than in SW. In the gill of FW-acclimated roughskin sculpin, aqp1 was also found to be up-regulated. Similarly, an increment of aqp1 expression was found in the intestine and liver along with the decreasing salinity. The results was not consistent with previous findings reporting more stimulated expression of aqp1 in the intestines of SW-acclimated fish than in those of FW-acclimated fish (Giffard-Mena et al., 2007; Raldúa et al., 2008).

      In fish, the information on the expression and function of aqp8 has been mostly focused on intestinal regulation (Cerdà and Finn, 2010; Choi et al., 2013; Cutler et al., 2009; Kim et al., 2010). The Oryzias dancena aqp8 was dominantly expressed in the intestine and spleen, moderately expressed in the kidney, while barely expressed in the liver (Kim et al., 2014). The presence of aqp8 in the gill, kidney and intestine of T. fasciatus has been confirmed in this study; no expression of aqp8 was detected in the liver before the treatments, however, the aqp8 expression was shown to be significantly activated by the osmotic treatments.

      In addition, higher aqp8 mRNA level was found in SW reared T. fasciatus, and the aqp8 mRNA level in the intestine decreased along with the decreasing salinity. Similarly, aqp8 in Anguilla japonica tended to be expressed to a higher level in the intestinal segments of SW-acclimated eel than in those of FW-acclimated eel (Kim et al., 2010). The intestinal aqp8 in Oncorhynchus nerka also increased after SW acclimation (Choi et al., 2013). Conversely, the intestinal aqp8 mRNA level in the marine medaka is higher in FW than in SW (Kim et al., 2014). Accordingly, significant difference was identified among species in the expression pattern of aqp8 when the fish were facing with salinity changes or osmotic stress.

      The distribution pattern of aqp10 was similar among different teleosts, in the sense of its abundant expression levels in the gonad, gill, intestine and kidney (Kim et al., 2014; Hamdi et al., 2009; Tingaud-Sequeira et al., 2010). However, this tissue distribution pattern could be greatly altered by salinity. For instance, the aqp10 level was exclusively higher in the gill, intestine, liver and spleen in the SW-acclimated than that in the FW-acclimated Japanese eel A. japonica. In this study, the aqp10 expression in the afore-mentioned tissues of T. fasciatus was found to be differently altered by the two different salinity treatments, but mostly the aqp10 mRNA level in the SW-acclimated fish was lower than that in the FW-acclimated fish.

      Expression profiles of aqp11 and aqp12 in different tissues of T. fasciatus were investigated under two acute salinity treatments (from SW to FW). As a result, expression of aqp11 and aqp12 in the osmoregulatory tissues were both increased along with the FW-acclimation, but their expression in the liver were down-regulated. In the gill and kidney of O. dancena, the aqp12 mRNA could be detected, but not in the same tissues of zebrafish (Kim et al., 2014; Gorelick et al., 2006). As two unorthodox aquaporins, aqp11 and aqp12 did not significantly induce the water permeability in oocytes expressing, but might be related to their intracellular localization in vivo (Gorelick et al., 2006; Itoh et al., 2005).

      In this study, variation of aqp11 and aqp12 expression in osmoregulatory tissues of T. fasciatus revealed the effect of salinity on mRNA level of these two genes, indicating that they might have participated in the molecular response to osmotic stress. Moreover, the heatmap indicated a similar trend of aqp11 and aqp12 expression in the liver and intestine, revealing a consistency between mRNA levels and orthologs.

    • In this study, two salinity treatments including one extreme acute and the other relatively chronic treatment was performed. In all the four tissues, the seven aqp genes exhibited a similar expression pattern between the two different treatments in most cases, suggesting that the aqp expression pattern may not be affected by the treatment strength. In addition, expression pattern of each aqp gene was tissue-specific, i.e., each tissue possessed its own expression patterns of aqp genes in response to the same salinity stress.

    • In this study, we investigated the effect of two different acute salinity treatments on various tissue distribution and expression pattern of aqp1, 4, 7, 8, 10, 11 and 12 in T. fasciatus. The qRT-PCR analyses showed that aqp transcripts are expressed in not only osmoregulatory tissues but also nonosmoregulatory tissues like liver. As for certain aqp gene such as aqp 4 and aqp7, their presence is only localized at specific tissues such as kidney. Although the overall tissue distribution pattern of aqps was not significantly different between FW- and SW-acclimated fish, the mRNA levels were largely variable among genes and tissues. Moreover, the salinity-dependent patterns of different aqp genes were also different among fish species, suggesting that the changes in transcription levels of aqps might be species- or lineage- specific. Further studies on the distribution of aqps in different cell types by performing salinity challenges are needed in order to specify the function of each aqp. Data from this study could serve fundamental basis to design gene expression assays with T. fasciatus aqp genes for a comprehensive understanding on the coordinated role of multi-genes in aqp superfamily in salinity adaptation of this euryhaline species.

Reference (44)

Catalog

    /

    DownLoad:  Full-Size Img  PowerPoint
    Return
    Return