Morphological, phylogenetic and metabolite profile of Prorocentrum clipeus, a newly recorded epiphytic dinoflagellate in the northern Yellow Sea
-
Abstract: More than 30 species of benthic Prorocentrum have been identified, some of which produce okadaic acid (OA) and its derivatives, dinophysistoxins (DTXs), which cause diarrhetic shellfish poisoning (DSP). Increasing numbers of benthic Prorocentrum species have been reported in tropical and subtropical waters of the China Sea. In contrast, only a few benthic Prorocentrum species have been reported in temperate waters. In this study, morphological descriptions obtained using light microscopy, scanning electron microscopy and molecular characterization of one Prorocentrum clipeus strain isolated from the Yellow Sea of China are presented. Prorocentrum clipeus cells were nearly circular in shape, with a collar, ridge, and one protrusion. The periflagellar area was wide U-shaped, with two curved projections on platelet 1a. Nine periflagellar platelets of different sizes were observed. The morphology closely fits that of the species isolated from other locations. Phylogenetic analysis based on the molecular sequences of the small subunit (SSU) rDNA, internal transcribed spacer (ITS), and large subunit (LSU) rDNA was performed. A comprehensive metabolomic analysis incorporating target, suspect and non-target screenings was first applied to investigate the intracellular and extracellular metabolite profiles of the current isolate of P. clipeus. According to the results of the target and suspect screenings, 179 metabolites or toxins produced by DSP-related algal species, including OA, dinophysistoxin-1 (DTX1), dinophysistoxin-2 (DTX2) and pectenotoxin-2 (PTX2), were not detected. Non-target screening involving feature-based molecular networking (FBMN) provided a global view of major metabolites produced by the P. clipeus DF128 strain and revealed 23 clusters belonging to at least 13 compound classes, with organometallic compounds, lipids and lipid-like molecules, phenylpropanoids and polyketides, and benzenoids as major types. To date, this is the first record of the characterization of P. clipeus in samples from Chinese waters. Our results support the wide distribution of epibenthic Prorocentrum species.
-
Key words:
- Prorocentrum /
- taxonomy /
- phylogeny /
- metabolite profiling /
- Yellow Sea
-
Figure 1. Light microscopy (LM) and scanning electron microscopy (SEM) images of P. clipeus DF128. LM, right thecal view showing the cell shape, the large nucleus (N) posterior (a). Laser scanning confocal microscopy images of P. clipeus (b - d). Epifluorescence image showing the pyrenoid (Py) and radial arrangement of chloroplasts (Chl) (b). Sybr Green stained cell showing the shape of the nucleus (N) (c). Epifluorescence image of the thecal valve of the cell (d). SEM. The right valve view shows that the cell shape is asymmetrical and round (e). SEM. Left valve view showing the smooth thecal surface with a radial pore pattern (f). SEM. The intercalary band is wide and has transverse striation (g). SEM. The cell is shown in the right lateral view, with a wide arc-shaped periflagellar area. Ridge (asterisk), wing-shaped protrusion (arrow), curved projections (arrowhead), detail of the nine platelets (h and i). Scale bars in a-g: 10 μm, h and i: 5 μm.
Figure 2. Maximum likelihood tree of 33 SSU rDNA sequences and 1691 positions. Alexandrium tamarense was included as an outgroup. The best model, chosen by MrModel-Test2.3, was GTR+I+G. The support values shown were obtained by maximum likelihood and Bayesian inference. Only values > 50% (ML) and 0.50 (BI) are shown. A new sequence published in this study is displayed in bold (OP601437).
Figure 3. Maximum likelihood tree of 32 ITS1–5.8S–ITS2 sequences and 623 positions. Karenia brevis was included as an outgroup. The best model, chosen by MrModel-Test2.3, was GTR+I+G. The support values shown were obtained by maximum likelihood and Bayesian inference. Only values > 50% (ML) and 0.50 (BI) are shown. A new sequence published in this study is displayed in bold (OP601439).
Figure 4. Maximum likelihood tree of 37 LSU rDNA sequences and 697 positions. Alexandrium tamarense was included as an outgroup. The best model, chosen by MrModel-Test2.3, was GTR+I+G. The support values shown were obtained by maximum likelihood and Bayesian inference. Only values > 50% (ML) and 0.50 (BI) are shown. A new sequence published in this study is displayed in bold (OP601441).
Figure 5. Extracted ion chromatograms (EICs) of the procedure blank; P. clipeus DF128 intracellular and extracellular extracts; and OA, DTX1 and DTX2 standards (100 ng/mL) in negative ESI mode using a Sciex QTRAP 5 500 system.
Figure 6. The EICs of the procedural blank, P. clipeus DF128 intracellular and extracellular extracts, and standard PTX2 (100 ng/mL) in positive ESI mode were determined using a Sciex QTRAP 5 500 system.
Figure 7. Enhanced molecular networks obtained from the positive ion mode (A) and negative ion mode (B) mass spectra using MolNetEnhancer showing different molecular families/clusters of the pooled metabolites in the extracts of P. clipeus DF128. The node colors represent the classes of putatively annotated metabolites matched in the GNPS libraries. Single nodes indicate the absence of MS/MS fragments shared with any other compound.
Figure 8. Global occurrence of P. clipeus (data from this paper indicated by double circle marker; data from published literature and OBIS from 2000 to 2019 in black). The figure was created using Ocean Data View, version 5.7.1(Schlitzer, 2023).
Table 1. Primer sequences used to amplify the SSU, ITS and LSU rDNA regions in Prorocentrum species
Name Target sequence Direction Sequence (5’ to 3’) Reference 18F23 SSU Forward GGTTGATCCTGCCAGTAG Olmos-Soto et al. (2002) 18R1780 SSU Reverse GTTCACCTACGGAAACCTTG Fu et al. (2008) SR4-F 548-566 SSU Forward AGGGCAAGTCTGGTGCCAG Hong et al. (2008) SR5kawR 630-611 SSU Reverse ACTACGAGCTTTTTAACCGC Hong et al. (2008) SR6-F 891-910 SSU Forward GTCAGAGGTGAAATTCTTGG Hong et al. (2008) SR7-R 951-932 SSU Reverse TCCTTGGCAAATGCTTTCGC Hong et al. (2008) SR9-R 1286-1267 SSU Reverse AACTAAGAACGGCCATGCAC Hong et al. (2008) ITS1-F ITS1-5.8S-ITS2 Forward TCCGTAGGTGAACCTGCGG White et al. (1990) ITS4-R ITS1-5.8S-ITS2 Reverse TCCTCCGCTTATTGATATGC White et al. (1990) DIR LSU Forward ACCCGCTGAATTTAAGCATA Scholin et al. (1994) D2C LSU Reverse CCTTGGTCCGTGTTTCAAGA Scholin et al. (1994) 
下载: 导出CSV
Table 2. Mass spectrometric parameters and retention times of the OA, DTX1, DTX2 and PTX2 standards *= Quantification ion; ^= Confirmation ion
Compound Molecular
formulaPrecursor
ion typePrecursor
ion (m/z)Fragment
ion (m/z)DP (V) EP (V) CE (eV) CXP (V) Retention
time (min)OA C44H68O13 [M − H] − 803.5 255.2* −70 −10 −60 −12 7.45 113.1^ −70 −10 −75 −12 DTX1 C45H70O13 [M − H] − 817.5 255.2* −110 −10 −68 −12 8.57 113.1^ −110 −10 −94 −12 DTX2 C44H68O13 [M − H] − 803.5 255.2* −70 −10 −60 −12 7.72 113.1^ −70 −10 −75 −12 PTX2 C47H70O14 [M + NH4] + 876.4 823.5* 150 10 27 15 7.94 805.5^ 150 10 35 15
下载: 导出CSV
Table 4. LSU rDNA sequence differences (above the diagonal line) and similarities (below the diagonal line) among P. clipeus, P. compressum and P. tsawwassenense based on a total of 697 positions
Species GenBank no/Strains, origin DF128 IFR459 IFR470 PCPA01 IFR456 P. clipeus OP601441/DF128, China − 39 39 95 140 P. clipeus JX912174/IFR459, France 94.4% − 0 104 121 P. clipeus JX912175/IFR470, France 94.4% 100% − 104 121 P. compressum AY259169/PCPA01, Australia 86.37% 85.08% 85.08% − 117 P. tsawwassenense JX912182/IFR456, France 79.91% 82.64% 82.64% 83.21% −
下载: 导出CSV
Table 3. Comparison of the morphological features of Prorocentrum clipeus and similar benthic Prorocentrum species
Characteristics P. clipeus (this study) P. clipeus1 P. clipeus2 P. compressum5 P. tsawwassenense7 P. panamense8 Cell shape Nearly round Nearly round Nearly circular Ovate to rotundate Oval Heart-shaped Cell size Length (µm) 37.8-41.3 54-55 37-55 (37-44)3; (30-35)4 30-50 (35-50)6 40-55 46-52 (52.3-55.6)9 Width (µm) 35.7-39.7 50-52.5 32-36.54 C. 25(20-30)6 30-47.5 43-46 (48.3-50.7)9 L/W 1.00-1.09 1.05-1.08 ? ? 1.06-1.139 Periflagellar area Shape Wide U-shaped Wide arc-shaped Wide U-shaped (arc) Slight depression Wide U-shaped “linear” Collar on left plate Yes Yes Yes No? Yes No Ridge on right plate Yes Yes Yes? No No No Wing-shaped spine No No No Yes “Yes” protrusions No Protrusions Only one Yes “Yes” apical spine Yes ? No More than one ? 5 (6)2 No Platelet list(s) No No No ? No No No. of platelets 9 10 9 ? 7-9 (8-10)2 ? 99 Flagellar pore Yes Yes Yes ? Yes Yes Accessory pore Yes Yes? Yes? ? Yes2 Yes Theca ornamentation Smooth Smooth Smooth Foveate6 Smooth Areolate (reticulate-foveate)2,9 Pore pattern Yes, some cell visible pore pattern or radial rows No, scattered No visible pore pattern or radial rows of small pores (radial rows)3 No, scattered (rows of pores)6 Radial rows
Two apical rowsNo, scattered on valves, mostly around Platelet pores Yes Yes Yes? ? No No Marginal pores No No ? ? Yes ? No5 Plate center Devoid Devoid ? Yes? Devoid ? (Devoid in some cells)2 Large pores (µm) No No ? ? 0.3-0.5 No Small pores (µm) Approximately 0.15 µm in diameter Approximately 0.12 µm in diameter ? ? 0.09-0.17 0.15 Intercalary band Transverse striation Smooth ? (horiz. str.)3 ? Transverse and horizontal striation Transversally striated Pyrenoid Yes (LSCM) Probably yes (LM) ? ? Yes (TEM) Yes Nucleus (shape and position) Large kidney-shaped, Posterior Large kidney-shaped, Posterior Kidney-shaped, Posterior ? Round to oval, Posterior U-shaped, Posterior In the above table, the list of morphological features was made based on Hoppenrath et al. (2013). It is listed here with some modifications. Where notifications in the table indicate: ? = no data available; …? = not mentioned in the text, inferred from images. Literature: 1Hoppenrath (2000); 2Hoppenrath et al. (2013); 3Murray (2003), 4Shah et al. (2013); 5Dodge (1975); 6Gul and Saifullah (2011); 7Hoppenrath and Leander (2008); 8Grzebyk et al. (1998); 9Luo et al. (2017).
下载: 导出CSV
-
Andersen R A. 2005. Algal Culturing Techniques. Oxford: Elsevier Academic Press, 578 Arteaga-Sogamoso E, Rodríguez F, Amato A, et al. 2023. Morphology and phylogeny of Prorocentrum porosum sp. nov. (Dinophyceae): a new benthic toxic dinoflagellate from the Atlantic and Pacific Oceans. Harmful Algae, 121: 102356, doi: 10.1016/j.hal.2022.102356 Blanco J, Moroño Á, Fernández M L. 2005. Toxic episodes in shellfish, produced by lipophilic phycotoxins: an overview. Galician: Revista Galega dos Recursos Mariños Galician Journal of Marine Resources, 1: 1–70 Boopathi T, Faria D G, Cheon J Y, et al. 2015. Implications of high molecular divergence of nuclear rRNA and phylogenetic structure for the dinoflagellate Prorocentrum (Dinophyceae, Prorocentrales). Journal of Eukaryotic Microbiology, 62(4): 519–531, doi: 10.1111/jeu.12206 Borsato G T, Salgueiro F, De’Carli G A L, et al. 2023. Taxonomy and abundance of epibenthic Prorocentrum (Dinophyceae) species from the tropical and subtropical Southwest Atlantic Ocean including a review of their global diversity and distribution. Harmful Algae, 127: 102470, doi: 10.1016/j.hal.2023.102470 Chomérat N, Bilien G, Zentz F. 2019. A taxonomical study of benthic Prorocentrum species (Prorocentrales, Dinophyceae) from Anse Dufour (Martinique Island, eastern Caribbean Sea). Marine Biodiversity, 49(3): 1299–1319, doi: 10.1007/s12526-018-0913-6 Chomérat N, Saburova M, Bilien G, et al. 2012. Prorocentrum bimaculatum sp. nov. (Dinophyceae, Prorocentrales), a new benthic dinoflagellate species from Kuwait (Arabian Gulf). Journal of Phycology, 48(1): 211–221, doi: 10.1111/j.1529-8817.2011.01102.x Chomérat N, Sellos D Y, Zentz F, et al. 2010. Morphology and molecular phylogeny of Prorocentrum consutum sp. nov. (Dinophyceae), a new benthic dinoflagellate from south brittany (northwestern France). Journal of Phycology, 46(1): 183–194, doi: 10.1111/j.1529-8817.2009.00774.x Chomérat N, Zentz F, Boulben S, et al. 2011. Prorocentrum glenanicum sp. nov. and Prorocentrum pseudopanamense sp. nov. (Prorocentrales, Dinophyceae), two new benthic dinoflagellate species from South Brittany (northwestern France). Phycologia, 50(2): 202–214, doi: 10.2216/10-12.1 Dodge J D. 1975. The Prorocentrales (Dinophyceae). II. Revision of the taxonomy within the genus Prorocentrum. Botanical Journal of the Linnean Society, 71(2): 103–125, doi: 10.1111/j.1095-8339.1975.tb02449.x Ehrenberg C. 1834. Dritter beitrag zur erkenntniss grosser organisation in der richtung des kleinsten raumes. Berlin: Abhandlungen der Königlichen Akademie der Wissenschaften zu, 1833: 145–336 Ernst M, Kang K B, Caraballo-Rodríguez A M, et al. 2019. MolNetEnhancer: enhanced molecular networks by integrating metabolome mining and annotation tools. Metabolites, 9(7): 144, doi: 10.3390/metabo9070144 European Food Safety Authority. 2008. Marine biotoxins in shellfish‐okadaic acid and analogues‐scientific opinion of the panel on contaminants in the food chain. European Food Safety Authority Journal, 6(1): 589, doi: 10.2903/j.efsa.2008.589 Faust M A, Vandersea M W, Kibler S R, et al. 2008. Prorocentrum levis, a new benthic species (Dinophyceae) from a mangrove island, Twin Cays, Belize. Journal of Phycology, 44(1): 232–240, doi: 10.1111/j.1529-8817.2007.00450.x Freudenthal A, Jijina J. 1988. Potential hazards of Dinophysis to consumers and shellfisheries. Journal of Shellfish Research, 7(1): 157–158 Fu X H, Meng F L, Hu Y, et al. 2008. Candida albicans, a distinctive fungal model for cellular aging study. Aging Cell, 7(5): 746–757, doi: 10.1111/j.1474-9726.2008.00424.x Glibert P M, Burkholder J M, Kana T M. 2012. Recent insights about relationships between nutrient availability, forms, and stoichiometry, and the distribution, ecophysiology, and food web effects of pelagic and benthic Prorocentrum species. Harmful Algae, 14: 231–259, doi: 10.1016/j.hal.2011.10.023 Gómez F, Gourvil P, Li T C, et al. 2023. Molecular phylogeny of the spiny‐surfaced species of the dinoflagellate Prorocentrum with the description of P. thermophilum sp. nov. and P. criophilum sp. nov. (Prorocentrales, Dinophyceae). Journal of Phycology, 59(1): 70–86, doi: 10.1111/jpy.13298 Grzebyk D, Sako Y, Berland B. 1998. Phylogenetic analysis of nine species of Prorocentrum (Dinophyceae) inferred from 18S ribosomal DNA sequences, morphological comparisons, and description of Prorocentrum panamensis, sp. nov. Journal of Phycology, 34(6): 1055–1068, doi: 10.1046/j.1529-8817.1998.341055.x Gul S, Saifullah S M. 2011. The dinoflagellate genus Prorocentrum (Prorocentrales, Prorocentraceae) from the north Arabian sea. Pakistan Journal of Botany, 43(6): 3061–3065 Gurevich A, Mikheenko A, Shlemov A, et al. 2018. Increased diversity of peptidic natural products revealed by modification-tolerant database search of mass spectra. Nature Microbiology, 3(3): 319–327, doi: 10.1038/s41564-017-0094-2 Hall T A. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41: 95–98 Han M S, Wang Pengbin, Kim J H, et al. 2016. Morphological and molecular phylogenetic position of Prorocentrum micans sensu stricto and description of Prorocentrum koreanum sp. nov. from southern coastal waters in Korea and Japan. Protist, 167(1): 32–50, doi: 10.1016/j.protis.2015.12.001 Henrichs D W, Scott P S, Steidinger K A, et al. 2013. Morphology and phylogeny of Prorocentrum texanum sp. nov. (Dinophyceae): a new toxic dinoflagellate from the Gulf of Mexico coastal waters exhibiting two distinct morphologies. Journal of Phycology, 49(1): 143–155, doi: 10.1111/jpy.12030 Holman J D, Tabb D L, Mallick P. 2014. Employing ProteoWizard to convert raw mass spectrometry data. Current Protocols in Bioinformatics, 46(1): 13.24. 1–13.24. 9, doi: 10.1002/0471250953.bi1324s46 Hong D D, Thu N T H, Nam H S, et al. 2008. The phylogenetic tree of Alexandrium, Prorocentrum and Pseudo-nitzschia of harmful and toxic algae in vietnam coastal waters based on sequences of 18s rDNA, ITS1-5.8S-ITS2 gene fragments and single cell-PCR method. Marine Research in Indonesia, 32(2): 203–218, doi: 10.14203/mri.v32i2.456 Hoppenrath M. 2000. A new marine sand-dwelling Prorocentrum species, P. clipeus sp. nov. (Dinophyceae, Prorocentrales) from Helgoland, German Bight, North Sea. European Journal of Protistology, 36(1): 29–33, doi: 10.1016/S0932-4739(00)80019-X Hoppenrath M, Chomérat N, Horiguchi T, et al. 2013. Taxonomy and phylogeny of the benthic Prorocentrum species (Dinophyceae)—a proposal and review. Harmful Algae, 27: 1–28, doi: 10.1016/j.hal.2013.03.006 Hoppenrath M, Leander B S. 2008. Morphology and molecular phylogeny of a new marine sand-dwelling Prorocentrum species, P. tsawwassenense (Dinophyceae, Prorocentrales), from British Columbia, Canada. Journal of Phycology, 44(2): 451–466, doi: 10.1111/j.1529-8817.2008.00483.x Hoppenrath M, Murray S A, Chomérat N, et al. 2014. Marine Benthic Dinoflagellates-Unveiling Their Worldwide Biodiversity. Stuttgart: Senckenberg, 137–138 Keller M D, Selvin R C, Claus W, et al. 1987. Media for the culture of oceanic ultraphytoplankton. Journal of Phycology, 23(4): 633–638, doi: 10.1111/j.1529-8817.1987.tb04217.x Jackson A E, Marr J C, Mclachlan J L. 1993. The production of diarrhetic shellfish toxins by an isolate of Prorocentrum lima from Nova Soctia, Canada. In: Smayda TJ, Shimizu Y, eds. Toxic Phytoplankton Blooms in the Sea. Newport: Elsevier, 513–518 Lim Z F, Luo Zhaohe, Lee L K, et al. 2019. Taxonomy and toxicity of Prorocentrum from Perhentian Islands (Malaysia), with a description of a non-toxigenic species Prorocentrum malayense sp. nov. (Dinophyceae). Harmful Algae, 83: 95–108, doi: 10.1016/j.hal.2019.01.007 Luo Zhaohe, Zhang Hua, Krock B, et al. 2017. Morphology, molecular phylogeny and okadaic acid production of epibenthic Prorocentrum (Dinophyceae) species from the northern South China Sea. Algal Research, 22: 14–30, doi: 10.1016/j.algal.2016.11.020 Mohimani H, Gurevich A, Shlemov A, et al. 2018. Dereplication of microbial metabolites through database search of mass spectra. Nature Communications, 9(1): 4035, doi: 10.1038/s41467-018-06082-8 Murray S. 2003. Diversity and phylogenetics of sand-dwelling dinoflagellates from southern Australia [dissertation]. Sydney: University of Sydney Murray S, Nagahama Y, Fukuyo Y. 2007. Phylogenetic study of benthic, spine-bearing prorocentroids, including Prorocentrum fukuyoi sp. nov. Phycological Research, 55(2): 91–102, doi: 10.1111/j.1440-1835.2007.00452.x Nascimento S M, Mendes M C Q, Menezes M, et al. 2017. Morphology and phylogeny of Prorocentrum caipirignum sp. nov. (Dinophyceae), a new tropical toxic benthic dinoflagellate. Harmful Algae, 70: 73–89, doi: 10.1016/j.hal.2017.11.001 Nothias L F, Petras D, Schmid R, et al. 2020. Feature-based molecular networking in the GNPS analysis environment. Nature Methods, 17(9): 905–908, doi: 10.1038/s41592-020-0933-6 Olmos-Soto J, Paniagua-Michel J, Contreras R, et al. 2002. Molecular identification of β-carotene hyper-producing strains of Dunaliella from saline environments using species-specific oligonucleotides. Biotechnology Letters, 24(5): 365–369, doi: 10.1023/A:1014516920887 Prabowo D A, Agusti S. 2019. Free-living dinoflagellates of the central Red Sea, Saudi Arabia: Variability, new records and potentially harmful species. Marine Pollution Bulletin, 141: 629–648, doi: 10.1016/j.marpolbul.2019.03.012 Rein K S, Snyder R V. 2006. The biosynthesis of polyketide metabolites by dinoflagellates. Advances in Applied Microbiology, 59: 93–125, doi: 10.1016/S0065-2164(06)59004-5 Ronquist F, Teslenko M, Van Der Mark P, et al. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61(3): 539–542, doi: 10.1093/sysbio/sys029 Schlitzer R. 2023. Ocean data view. http://odv.awi.de Schmid R, Heuckeroth S, Korf A, et al. 2023. Integrative analysis of multimodal mass spectrometry data in MZmine 3. Nature Biotechnology, 41(4): 447–449, doi: 10.1038/s41587-023-01690-2 Scholin C A, Herzog M, Sogin M, et al. 1994. Identification of group‐and strain‐specific genetic markers for globally distributed Alexandrium (Dinophyceae). II. Sequence analysis of a fragment of the LSU rRNA gene. Journal of Phycology, 30(6): 999–1011, doi: 10.1111/j.0022-3646.1994.00999.x Shah M M R, An S J, Lee J B. 2013. Presence of benthic dinoflagellates around coastal waters of Jeju Island including newly recorded species. Journal of Ecology and Environment, 36(4): 347–370, doi: 10.5141/ecoenv.2013.347 Shannon P, Markiel A, Ozier O, et al. 2003. Cytoscape: a software environment for integrated models of biomolecular interaction networks. Genome Research, 13(11): 2498–2504, doi: 10.1101/gr.1239303 Swofford D L, 2002. PAUP: phylogenetic analysis using parsimony, version 4.0 b10. Sinauer Associates, Sunderland, MA Ten-Hage L, Turquet J, Quod J P, et al. 2000. Prorocentrum borbonicum sp. nov. (Dinophyceae), a new toxic benthic dinoflagellate from the southwestern Indian Ocean. Phycologia, 39(4): 296–301, doi: 10.2216/i0031-8884-39-4-296.1 Thompson J D, Higgins D G, Gibson T J. 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids research, 22(22): 4673–4680, doi: 10.1093/nar/22.22.4673 Tillmann U, Gottschling M, Wietkamp S, et al. 2023a. Morphological and phylogenetic characterisation of Prorocentrum spinulentum, sp. nov. (Prorocentrales, Dinophyceae), a small spiny species from the North Atlantic. Microorganisms, 11(2): 271, doi: 10.3390/microorganisms11020271 Tillmann U, Hoppenrath M, Gottschling M. 2019. Reliable determination of Prorocentrum micans Ehrenb. (Prorocentrales, Dinophyceae) based on newly collected material from the type locality. European Journal of Phycology, 54(3): 417–431, doi: 10.1080/09670262.2019.1579925 Tillmann U, Wietkamp S, Gottschling M, et al. 2023b. Prorocentrum pervagatum sp. nov. (Prorocentrales, Dinophyceae): a new, small, planktonic species with a global distribution. Phycological Research, 71(1): 56–71, doi: 10.1111/pre.12502 Verma A, Kazandjian A, Sarowar C, et al. 2019. Morphology and phylogenetics of benthic Prorocentrum Species (Dinophyceae) from tropical northwestern Australia. Toxins, 11(10): 571, doi: 10.3390/toxins11100571 Wan Xiukun, Yao Ge, Liu Yanli, et al. 2019. Research progress in the biosynthetic mechanisms of marine polyether toxins. Marine Drugs, 17(10): 594, doi: 10.3390/md17100594 Wu Yixuan, Huang Shuning, Krock B, et al. 2022. Cryptic speciation of benthic Prorocentrum (Dinophyceae) species and their potential as ecological indicators. Journal of Sea Research, 190: 102304, doi: 10.1016/j.seares.2022.102304 White T J, Bruns T, Lee S, et al. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis M A, Gelfand D H, Sninsky J J, et al, eds. PCR Protocols: A Guide to Methods and Applications. New York: Academic Press, 315–322, doi: 10.1016/B978-0-12-372180-8.50042-1 Xie Hang, Zou Jian, Zheng Chengzhi, et al. 2022. Biodiversity and distribution of benthic dinoflagellates in tropical Zhongsha Islands, South China Sea. Journal of Oceanology and Limnology, 40(6): 2120–2145, doi: 10.1007/s00343-022-1322-z Yasumoto T, Murata M, Oshima Y, et al. 1985. Diarrhetic shellfish toxins. Tetrahedron, 41(6): 1019–1025, doi: 10.1016/S0040-4020(01)96469-5 Zhang Hua, Li Yang, Cen Jingyi, et al. 2015. Morphotypes of Prorocentrum lima (Dinophyceae) from Hainan island, South China Sea: morphological and molecular characterization. Phycologia, 54(5): 503–516, doi: 10.2216/15-8.1 Zou Jian, Li Qun, Liu Hui, et al. 2022. Taxonomy and toxin profile of harmful benthic Prorocentrum (Dinophyceae) species from the Xisha Islands, South China Sea. Journal of Oceanology and Limnology, 40(3): 1171–1190, doi: 10.1007/s00343-021-1045-6 Zou Jian, Li Qun, Lu Songhui, et al. 2020. The first benthic harmful dinoflagellate bloom in China: morphology and toxicology of Prorocentrum concavum. Marine Pollution Bulletin, 158: 111313, doi: 10.1016/j.marpolbul.2020.111313 -
点击查看大图
计量
- 文章访问数: 154
- HTML全文浏览量: 65
- 被引次数: 0
