Characterization of ghrelin mRNA expression in fasting Larimichthys crocea juveniles
-
Abstract: Larimichthys crocea is a marine fish species cultured in China. Short-term starvation is often applied to improve the quality of cultured L. crocea, and the expression of ghrelin in tissues of stomach, muscle, brain, intestines, liver, and kidney, involved in starvation response, under starvation conditions were studied to understand the effect of starvation on the expression of ghrelin in L. crocea juveniles. The ghrelin expression was tissue-specific, and expression was significantly higher in the stomach compared to other tissues (P<0.01). Additionally, ghrelin expression in different tissues changed along with prolongation of fasting. In the stomach, ghrelin expression levels increased gradually at the beginning of the fast, and then declined after eight days of fasting. Gene expression in the brain and intestines increased at the beginning of the fast, and then decreased with longer fasting time. Interestingly, ghrelin expression declined at the beginning of the fast, then increased with longer fasting in the kidneys and muscles. These results suggest that ghrelin is involved in starvation response in L. crocea juveniles. This study provids insights into ghrelin function and an important reference for the development of reasonable feeding strategies for L. crocea juveniles.
-
Key words:
- Larimichthys crocea /
- starvation /
- ghrelin /
- gene expression
-
Figure 1. Multiple alignment of ghrelin amino acid sequences. The comparison includes ghrelin sequences from the teleost species O. mykiss (BAD02980.1), S. salar (NP_001133057.1), L. crocea (NP_001290260.1), E. coioides (AJS13600.1), S. chuatsi (ALB25888.1), D. labrax (ABG49130.1), A. schlegelii (AAV65509.1), Oncorhynchus mossambicus (BAC55160.1), S. richardsonii (AWB11399.1), M. piceus (AIZ50369.1), D. rerio (ACJ76436.1). Identical amino acids are highlighted in black, strongly similar amino acids are printed in white letters with dark gray underline.
Figure 2. Phylogenetic trees analysis based on ghrelin amino sequences. GenBank Accession numbers of sequences used are R. norvegicus (BAA89370.1), M. mulatta (AAQ74381.1), H. sapiens (ADM33790.1), G. gallus (AAP57945.1), X. laevis (BAL70270.1), C. pyrrhogaster (BAM29300.1), S. richardsonii (AWB11399.1), M. piceus (AIZ50369.1), D. rerio (ACJ76436.1), T. fulvidraco (ALK82256.1), Oncorhynchus mykiss (BAD02980.1), S. salar (NP_001133057.1), O. mossambicus (BAC55160.1), L. crocea (NP_001290260.1), E. coioides (AJS13600.1), S. chuatsi (ALB25888.1), D. labrax (ABG49130.1), and A. schlegelii (AAV65509.1).
Figure 3. Expression of ghrelin mRNA in different tissues of L. crocea juvelines. Expression levels of all tissues are expressed relative to the brain. Data are shown as mean±SEM (n=9). Significant differences are indicated with different lowercase letters above the vertical bars (P<0.05).
Figure 4. Relative expression level of ghrelin in tissues of L. crocea juveniles treated with different lengths of fasting for stomach (a), muscle (b), brain (c), intestine (d), liver (e), and kidney (f). Expression levels were normalized as the average expression levels of the treatment group where the expression levels the control group (0 d) were set as 1. Data are shown as mean±SEM (n=9). Significant differences are indicated with different lowercase letters above the vertical bars (P<0.05).
Table 1. List of PCR primers used in this study
Gene Primer name Sequence (5′–3′) Product length/bp ghrelin Ghrelin_F CTTCCTCAGCCCTTCACAAA 198 Ghrelin_R AGACGCTGAATGATCTCCTG β-actin β-actin_F CCAACTCATTGGCATGGCTT 134 β-actin_R GATGCAACTGCAGAACCCTG 
下载: 导出CSV
-
[1] Amole N, Unniappan S. 2009. Fasting induces preproghrelin mRNA expression in the brain and gut of zebrafish, Danio rerio. General and Comparative Endocrinology, 161(1): 133–137. doi: 10.1016/j.ygcen.2008.11.002 [2] Arvat E, Di Vito L, Broglio F, et al. 2000. Preliminary evidence that Ghrelin, the natural GH secretagogue (GHS)-receptor ligand, strongly stimulates GH secretion in humans. Journal of Endocrinological Investigation, 23(8): 493–495. doi: 10.1007/bf03343763 [3] Cui Wentao. 2013. Cloning and distribution of three kinds of gastrointestinal peptide cDNAs in large yellow croaker (Pseudosciaena crocea) (in Chinese) [dissertation]. Zhoushan: Zhejiang Ocean University [4] Diéguez C, da Boit K, Novelle M G, et al. 2010. New insights in ghrelin orexigenic effect. Frontiers of Hormone Research, 38: 196–205. doi: 10.1159/000318511 [5] Feng Zhaoxin. 1979. Ichthyology (in Chinese). Beijing: Agricultural Press House, 217 [6] Feng Ke, Zhang Guirong, Wei Kaijian, et al. 2013. Molecular cloning, tissue distribution, and ontogenetic expression of ghrelin and regulation of expression by fasting and refeeding in the grass carp (Ctenopharyngodon idellus). Journal of Experimental Zoology Part A: Ecological & Integrative Physiology, 319(4): 202–212. doi: 10.1002/jez.1784 [7] Fox B K, Breves J P, Hirano T, et al. 2009. Effects of short- and long-term fasting on plasma and stomach ghrelin, and the growth hormone/insulin-like growth factor I axis in the tilapia, Oreochromis mossambicus. Domestic Animal Endocrinology, 37(1): 1–11. doi: 10.1016/j.domaniend.2009.01.001 [8] Gao Fengying, Wang Huan, Lu Maixin, et al. 2010. cDNA cloning and expression characterization of ghrelin of Zanzibar tilapia, Oreochromis hornorum. Journal of Huazhong Agricultural University (in Chinese), 29(6): 752–757 [9] Ginés R, Palicio M, Zamorano M J, et al. 2002. Starvation before slaughtering as a tool to keep freshness attributes in gilthead sea bream (Sparus aurata). Aquaculture International, 10(5): 379–389. doi: 10.1023/A:1023365025292 [10] Heijboer A C, van den Hoek A M, Parlevliet E T, et al. 2006. Ghrelin differentially affects hepatic and peripheral insulin sensitivity in mice. Diabetologia, 49(4): 732–738. doi: 10.1007/s00125–006-0138–2 [11] Hosoda H, Kojima M, Matsuo H, et al. 2000. Ghrelin and des-acyl ghrelin: two major forms of rat ghrelin peptide in gastrointestinal tissue. Biochemical and Biophysical Research Communications, 279(3): 909–913. doi: 10.1006/bbrc.2000.4039 [12] Jönsson E. 2013. The role of ghrelin in energy balance regulation in fish. General and Comparative Endocrinology, 187: 79–85. doi: 10.1016/j.ygcen.2013.03.013 [13] Kaiya H, Kojima M, Hosoda H, et al. 2003a. Peptide purification, complementary deoxyribonucleic acid (DNA) and genomic DNA cloning, and functional characterization of ghrelin in rainbow trout. Endocrinology, 144(12): 5215–5226. doi: 10.1210/en.2003–1085 [14] Kaiya H, Kojima M, Hosoda H, et al. 2003b. Amidated fish ghrelin: purification, cDNA cloning in the Japanese eel and its biological activity. Journal of Endocrinology, 176(3): 415–423. doi: 10.1677/joe.0.1760415 [15] Kaiya H, Kojima M, Hosoda H, et al. 2003c. Identification of tilapia ghrelin and its effects on growth hormone and prolactin release in the tilapia, Oreochromis mossambicus. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 135(3): 421–429. doi: 10.1016/s1096–4959(03)00109-x [16] Kaiya H, Small B C, Bilodeau A L, et al. 2005. Purification, cDNA cloning, and characterization of ghrelin in channel catfish, Ictalurus punctatus. General and Comparative Endocrinology, 143(3): 201–210. doi: 10.1016/j.ygcen.2005.03.012 [17] Karapanagiotou E M, Polyzos A, Dilana K D, et al. 2009. Increased serum levels of ghrelin at diagnosis mediate body weight loss in non-small cell lung cancer (NSCLC) patients. Lung Cancer, 66(3): 393–398. doi: 10.1016/j.lungcan.2009.02.006 [18] Kojima M, Hosoda H, Date Y, et al. 1999. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature, 402(6762): 656–660. doi: 10.1038/45230 [19] Kono T, Kitao Y, Sonoda K, et al. 2008. Identification and expression analysis of ghrelin gene in common carp Cyprinus carpio. Fisheries Science, 74(3): 603–612. doi: 10.1111/j.1444–2906.2008.01564.x [20] Li Wenjie, Ai Qinghui, Mai Kangsen, et al. 2013. Effects of dietary amino acid patterns on growth and protein metabolism of large yellow croaker (Larimichthys crocea) larvae. Aquaculture, 406–407: 1–8. doi: 10.1016/j.aquaculture.2013.04.029 [21] Ma Xilan, Zhang Yong, Liu Yun, et al. 2009. Effect of different fasting stages on ghrelin expression in Black Sea Bream, Acanthopagrus schlegeli. Oceanologia et Limnologia Sinica (in Chinese), 40(3): 313–318 [22] Murashita K, Kurokawa T, Nilsen T O, et al. 2009. Ghrelin, cholecystokinin, and peptide YY in Atlantic salmon (Salmo salar): molecular cloning and tissue expression. General and Comparative Endocrinology, 160(3): 223–235. doi: 10.1016/j.ygcen.2008.11.024 [23] Olsson C, Holbrook J D, Bompadre G, et al. 2008. Identification of genes for the ghrelin and motilin receptors and a novel related gene in fish, and stimulation of intestinal motility in zebrafish (Danio rerio) by ghrelin and motilin. General and Comparative Endocrinology, 155(1): 217–226. doi: 10.1016/j.ygcen.2007.05.016 [24] Parhar I S, Sato H, Sakuma Y. 2003. Ghrelin gene in cichlid fish is modulated by sex and development. Biochemical and Biophysical Research Communications, 305(1): 169–175. doi: 10.1016/s0006–291x(03)00729–0 [25] Peddu S C, Breves J P, Kaiya H, et al. 2009. Pre- and postprandial effects on ghrelin signaling in the brain and on the GH/IGF-I axis in the Mozambique tilapia (Oreochromis mossambicus). General and Comparative Endocrinology, 161(3): 412–418. doi: 10.1016/j.ygcen.2009.02.008 [26] Pusztai P, Sarman B, Ruzicska E, et al. 2008. Ghrelin: a new peptide regulating the neurohormonal system, energy homeostasis and glucose metabolism. Diabetes/Metabolism Research and Reviews, 24(5): 343–352. doi: 10.1002/dmrr.830 [27] Riley L G, Fox B K, Breves J P, et al. 2008. Absence of effects of short-term fasting on plasma ghrelin and brain expression of ghrelin receptors in the Tilapia, Oreochromis mossambicus. Zoological Science, 25(8): 821–827. doi: 10.2108/zsj.25.821 [28] Terova G, Rimoldi S, Bernardini G, et al. 2008. Sea bass ghrelin: molecular cloning and mRNA quantification during fasting and refeeding. General and Comparative Endocrinology, 155(2): 341–351. doi: 10.1016/j.ygcen.2007.05.028 [29] Thakur D P, Morioka K, Itoh Y, et al. 2003. Lipid composition and deposition of cultured yellowtail Seriola quinqueradiata muscle at different anatomical locations in relation to meat texture. Fisheries Science, 69(3): 487–494. doi: 10.1046/j.1444–2906.2003.00649.x [30] Unniappan S, Canosa L F, Peter R E. 2004. Orexigenic actions of ghrelin in goldfish: feeding-induced changes in brain and gut mRNA expression and serum levels, and responses to central and peripheral injections. Neuroendocrinology, 79(2): 100–108. doi: 10.1159/000076634 [31] Volkoff H. 2015. Cloning, tissue distribution and effects of fasting on mRNA expression levels of leptin and ghrelin in red-bellied piranha (Pygocentrus nattereri). General and Comparative Endocrinology, 217–218: 20–27. doi: 10.1016/j.ygcen.2015.05.004 [32] Volkoff H, Peter R E. 2006. Feeding behavior of fish and its control. Zebrafish, 3(2): 131–140. doi: 10.1089/zeb.2006.3.131 [33] Wang Le, Shi Xiaofeng, Su Yongquan, et al. 2012. Loss of genetic diversity in the cultured stocks of the large yellow croaker, Larimichthys crocea, revealed by microsatellites. International Journal of Molecular Sciences, 13(5): 5584–5597. doi: 10.3390/ijms13055584 [34] Wang Qianfeng, Shen Weiliang, Liu Cheng, et al. 2017. Effects of multi-environmental factors on physiological and biochemical responses of large yellow croaker, Larimichthys crocea. Chemosphere, 184: 907–915. doi: 10.1016/j.chemosphere.2017.06.043 [35] Wren A M, Bloom S R. 2007. Gut hormones and appetite control. Gastroenterology, 132(6): 2116–2130. doi: 10.1053/j.gastro.2007.03.048 [36] Wren A M, Small C J, Ward H L, et al. 2000. The novel hypothalamic peptide Ghrelin stimulates food intake and growth hormone secretion. Endocrinology, 141(11): 4325–4328. doi: 10.1210/endo.141.11.7873 [37] Xing Shujuan, Sun Ruijian, Pan Xiaoyi, et al. 2016. Effects of dietary carbohydrate-to-lipid ratio on growth performance, body composition, digestive enzyme activities, and hepatic enzyme activities in juvenile large yellow croaker, Larimichthys crocea. Journal of the World Aquaculture Society, 47(2): 297–307. doi: 10.1111/jwas.12259 [38] Xu Meiyu, Volkoff H. 2009. Molecular characterization of ghrelin and gastrin-releasing peptide in Atlantic cod (Gadus morhua): Cloning, localization, developmental profile and role in food intake regulation. General and Comparative Endocrinology, 160(3): 250–258. doi: 10.1016/j.ygcen.2008.12.004 [39] Ye Hua, Liu Yang, Liu Xiande, et al. 2014. Genetic mapping and QTL analysis of growth traits in the large yellow croaker Larimichthys crocea. Marine Biotechnology, 16(6): 729–738. doi: 10.1007/s10126–014-9590-z [40] Yeung C M, Chan C B, Woo N Y, et al. 2006. Seabream ghrelin: cDNA cloning, genomic organization and promoter studies. Journal of Endocrinology, 189(2): 365–379. doi: 10.1677/joe.1.06593 [41] Zhang Hanle, Sun Ruijian, Xu Wei, et al. 2016a. Dietary manganese requirement of juvenile large yellow croaker Larimichthys crocea (Richardson, 1846). Aquaculture, 450: 74–79. doi: 10.1016/j.aquaculture.2015.07.010 [42] Zhang Zhenyu, Wang Qiurong, Ye Kun, et al. 2016b. Effect of fasting on body composition, muscle fatty acid profiles and serum biochemical parameters of large yellow croaker (Larimichthys crocea). Journal of Fisheries of China (in Chinese), 40(9): 1440–1450 [43] Zhou Chaowei, Zhang Xingdong, Liu Tao, et al. 2014. Schizothorax davidi ghrelin: cDNA cloning, tissue distribution and indication for its stimulatory character in food intake. Gene, 534(1): 72–77. doi: 10.1016/j.gene.2013.10 -
点击查看大图
图(4) / 表(1)
计量
- 文章访问数: 868
- HTML全文浏览量: 315
- PDF下载量: 16
- 被引次数: 0
